Review



target sequences shnc  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech target sequences shnc
    Target Sequences Shnc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pm42107206-51-2-19?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    target sequences shnc - by Bioz Stars, 2026-08
    86/100 stars

    Images



    Similar Products

    target sequences shnc  (Sangon Biotech)
    86
    Sangon Biotech target sequences shnc
    Target Sequences Shnc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pm42107206-51-2-19?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    target sequences shnc - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    lentiviral plasmid containing non-target control sequence (shnc)  (Shanghai Genechem Ltd)
    90
    Shanghai Genechem Ltd lentiviral plasmid containing non-target control sequence (shnc)
    Lentiviral Plasmid Containing Non Target Control Sequence (Shnc), supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pmc11740035-103-1-26?v=Shanghai+Genechem+Ltd
    Average 90 stars, based on 1 article reviews
    lentiviral plasmid containing non-target control sequence (shnc) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    corresponding non-targeting sequences (shnc)  (GenScript corporation)
    90
    GenScript corporation corresponding non-targeting sequences (shnc)
    Corresponding Non Targeting Sequences (Shnc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pm37708708-71-20-29?v=GenScript+corporation
    Average 90 stars, based on 1 article reviews
    corresponding non-targeting sequences (shnc) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    sequences targeting prncr1 and shnc  (Shanghai GenePharma)
    90
    Shanghai GenePharma sequences targeting prncr1 and shnc
    Sequences Targeting Prncr1 And Shnc, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pm33647908-61-6-10?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    sequences targeting prncr1 and shnc - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    lentiviral plasmids containing shrna sequences targeting cenpk and yap1 (shcenpk and shyap1) or negative control (shnc)  (Genechem)
    90
    Genechem lentiviral plasmids containing shrna sequences targeting cenpk and yap1 (shcenpk and shyap1) or negative control (shnc)
    Lentiviral Plasmids Containing Shrna Sequences Targeting Cenpk And Yap1 (Shcenpk And Shyap1) Or Negative Control (Shnc), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/10__2147_slash_ott__s190061-38-12-25?v=Genechem
    Average 90 stars, based on 1 article reviews
    lentiviral plasmids containing shrna sequences targeting cenpk and yap1 (shcenpk and shyap1) or negative control (shnc) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    pgpu6/gfp/neo-shnc (target sequence, gttctccgaacgtgtcacgt)  (Shanghai GenePharma)
    90
    Shanghai GenePharma pgpu6/gfp/neo-shnc (target sequence, gttctccgaacgtgtcacgt)
    Pgpu6/Gfp/Neo Shnc (Target Sequence, Gttctccgaacgtgtcacgt), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+sequences+shnc/pmc06019939-155-0-16?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    pgpu6/gfp/neo-shnc (target sequence, gttctccgaacgtgtcacgt) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier

    Image Search Results